Mature hsa-miR-4691-3p
| Accession | MIMAT0019782 |
| Description | hsa-miR-4691-3p mature miRNA |
| Hairpins | |
| Sequence | CCAGCCACGGACUGAGAGUGCAU |
| Evidence |
experimental
Illumina [1] |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:37403426 | has_input UniProtKB:Q86WV6 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:37403426 | |
| involved_in | GO:0045824 negative regulation of innate immune response |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:37403426 | |
| involved_in | GO:0160049 negative regulation of cGAS/STING signaling pathway |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:37403426 | |
| is_active_in | GO:0005829 cytosol |
ECO:0000305 curator inference used in manual assertion |
PMID:37403426 |
