Home
(current)
Search
Browse
Help
Downloads
Home
(current)
Search
Browse
Help
Downloads
miRBase entry: hco-miR-265
Mature
hco-miR-265
Accession
MIMAT0023508
Description
hco-miR-265 mature miRNA
Hairpins
hco-mir-265
Sequence
UGAGGGAGGAAGGGAAUAAU
Copy Sequence
Evidence
experimental
Illumina [1]