Home
(current)
Search
Browse
Help
Downloads
Home
(current)
Search
Browse
Help
Downloads
miRBase entry: ggo-miR-518e-5p
Mature
ggo-miR-518e-5p
Accession
MIMAT0036427
Description
ggo-miR-518e-5p mature miRNA
Hairpins
ggo-mir-518e
Sequence
CUCUAGAGGGAAGCGCUUUCUG
Copy Sequence
Evidence
not_experimental