Mature sequence hsa-miR-380-3p

Accession numberMIMAT0000735
IDhsa-miR-380-3p
Previous IDshsa-miR-380-3p;hsa-miR-380
Stem-Loop hsa-mir-380
Sequence
uauguaauaugguccacaucuu
Get sequence
Deep sequencing377 reads, 50 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15310658 "A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain" Seitz H, Royo H, Bortolin ML, Lin SP, Ferguson-Smith AC, Cavaille J Genome Res. 14:1741-1748(2004).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).