Mature sequence cel-miR-392-3p

• Accession number: MIMAT0000768
• ID: cel-miR-392-3p
• Previous IDs: cel-miR-392
• Stem-Loop: cel-mir-392
• Sequence: uaucaucgaucacgugugauga
• Deep sequencing: 120 reads, 11 experiments
• Database links:
  • RNAcentral:URS0000351D9F_6239
• Predicted targets:
  • TargetScanWorm:cel-miR-392
  • microrna.org:cel-miR-392-3p

References

1. PMID:15317971 "Patterns of flanking sequence conservation and a characteristic upstream motif for microRNA gene identification" Ohler U, Yekta S, Lim LP, Bartel DP, Burge CB RNA. 10:1309-1322(2004).
2. PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
3. PMID:19460142 "Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development" Kato M, de Lencastre A, Pincus Z, Slack FJ Genome Biol. 10:R54(2009).
4. PMID:21307183 "Improved annotation of C. elegans microRNAs by deep sequencing reveals structures associated with processing by Drosha and Dicer" Warf MB, Johnson WE, Bass BL RNA. 17:563-577(2011).