Mature sequence rno-miR-135a-5p

Accession numberMIMAT0000841
IDrno-miR-135a-5p
Previous IDsrno-miR-135a
Stem-Loop rno-mir-135a
Sequence
uauggcuuuuuauuccuauguga
Get sequence
Deep sequencing43509 reads, 319 experiments
Predicted targets

References

1
PMID:16471176 "Assessment of the microRNA system in salt-sensitive hypertension" Naraba H, Iwai N Hypertens Res. 28:819-826(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).