Mature sequence osa-miR399h

Accession numberMIMAT0000991
IDosa-miR399h
Stem-Loop osa-MIR399h
Sequence
ugccaaaggagacuugcccag
Get sequence
Deep sequencing7 reads, 2 experiments
Database links
QuickGO function

References

1