Mature sequence osa-miR399i

Accession numberMIMAT0000992
IDosa-miR399i
Stem-Loop osa-MIR399i
Sequence
ugccaaaggagagcugcccug
Get sequence
Deep sequencing6 reads, 2 experiments

References

1