Mature sequence osa-miR156k

Accession numberMIMAT0001020
IDosa-miR156k
Stem-Loop osa-MIR156k
Sequence
ugacagaagagagagagcaca
Get sequence
Deep sequencing378295 reads, 2 experiments
Database links
QuickGO function

References

1