Mature sequence osa-miR168b

Accession numberMIMAT0001046
IDosa-miR168b
Stem-Loop osa-MIR168b
Sequence
aggcuuggugcagcucgggaa
Get sequence
Deep sequencing830 reads, 2 experiments

References

1