Mature sequence osa-miR169m

Accession numberMIMAT0001058
IDosa-miR169m
Stem-Loop osa-MIR169m
Sequence
uagccaaggaugacuugccug
Get sequence
Deep sequencing5636 reads, 2 experiments
Database links
QuickGO function

References

1