Mature sequence osa-miR169n

Accession numberMIMAT0001059
IDosa-miR169n
Stem-Loop osa-MIR169n
Sequence
uagccaagaaugacuugccua
Get sequence
Deep sequencing1345 reads, 2 experiments
Database links
QuickGO function

References

1