Mature sequence gga-miR-199-5p

Accession numberMIMAT0001152
IDgga-miR-199-5p
Previous IDsgga-miR-199a;gga-miR-199
Stem-Loop gga-mir-199-2 gga-mir-199-1
Sequence
cccaguguucagacuaccuguuc
Get sequence
Deep sequencing22116 reads, 5 experiments
Database links
Predicted targets
QuickGO function

References

1
" McBride D, Carre W, Law A, Clinton M Unpublished.
2
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
3
PMID:16750530 "Identification of microRNAs from different tissues of chicken embryo and adult chicken" Xu H, Wang X, Du Z, Li N FEBS Lett. 580:3610-3616(2006).