Mature sequence dps-miR-87

Accession numberMIMAT0001225
IDdps-miR-87
Stem-Loop dps-mir-87
Sequence
uugagcaaaauuucaggugug
Get sequence
Deep sequencing reads, experiments

References