Mature sequence aga-miR-210

Accession numberMIMAT0001505
IDaga-miR-210
Stem-Loop aga-mir-210
Sequence
uugugcgugugacaacggcua
Get sequence
Deep sequencing reads, experiments

References