Mature sequence dre-miR-10c-5p

Accession numberMIMAT0001770
IDdre-miR-10c-5p
Previous IDsdre-miR-10c
Stem-Loop dre-mir-10c
Sequence
uacccuguagauccggauuugu
Get sequence
Deep sequencing60699 reads, 11 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).