Mature sequence dre-miR-137-3p

Accession numberMIMAT0001834
IDdre-miR-137-3p
Previous IDsdre-miR-137
Stem-Loop dre-mir-137-1 dre-mir-137-2 dre-mir-137-3
Sequence
uuauugcuuaagaauacgcgua
Get sequence
Deep sequencing6196 reads, 9 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).