Mature sequence dre-miR-454a

Accession numberMIMAT0001877
IDdre-miR-454a
Stem-Loop dre-mir-454a
Sequence
uagugcaauauugcuaauaggg
Get sequence
Deep sequencing22229 reads, 11 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).