Mature sequence fru-let-7e

Accession numberMIMAT0002898
IDfru-let-7e
Stem-Loop fru-let-7e
Sequence
ugagguaguagauugaauaguu
Get sequence
Deep sequencing reads, experiments

References