Mature sequence fru-let-7a

Accession numberMIMAT0002928
IDfru-let-7a
Stem-Loop fru-let-7a-3 fru-let-7a-2 fru-let-7a-1
Sequence
ugagguaguagguuguauaguu
Get sequence
Deep sequencing reads, experiments

References