Mature sequence tni-let-7j

Accession numberMIMAT0003014
IDtni-let-7j
Stem-Loop tni-let-7j
Sequence
ugagguaguuuuuuguacaguu
Get sequence
Deep sequencing reads, experiments

References