Mature sequence hsa-miR-551a

Accession numberMIMAT0003214
IDhsa-miR-551a
Stem-Loop hsa-mir-551a
Sequence
gcgacccacucuugguuucca
Get sequence
Deep sequencing786 reads, 81 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).