Mature sequence dre-miR-133a-5p

Accession numberMIMAT0003404
IDdre-miR-133a-5p
Previous IDsdre-miR-133a*
Stem-Loop dre-mir-133a-1
Sequence
agcugguaaaauggaaccaaau
Get sequence
Deep sequencing7166 reads, 5 experiments
Database links
QuickGO function

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).