Mature sequence mdo-miR-200a-5p

Accession numberMIMAT0004157
IDmdo-miR-200a-5p
Previous IDsmdo-miR-200a*
Stem-Loop mdo-mir-200a
Sequence
caucuuacuagacagugcugga
Get sequence
Deep sequencing290 reads, 3 experiments
Predicted targets

References

1