Mature sequence ppt-miR900-3p

Accession numberMIMAT0004370
IDppt-miR900-3p
Previous IDsppt-miR900
Stem-Loop ppt-MIR900
Sequence
uguguucuuguaccugggaag
Get sequence
Deep sequencing reads, experiments

References

1
PMID:17359535 "Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution" Fattash I, Voss B, Reski R, Hess WR, Frank W BMC Plant Biol. 7:13(2007).
2
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).