Mature sequence hsa-miR-190b-5p

Accession numberMIMAT0004929
IDhsa-miR-190b-5p
Stem-Loop hsa-mir-190b
Sequence
ugauauguuugauauuggguug
Get sequence
Deep sequencing5587 reads, 132 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).