Mature sequence rno-miR-760-3p

Accession numberMIMAT0005337
IDrno-miR-760-3p
Stem-Loop rno-mir-760
Sequence
cggcucugggucugugggga
Get sequence
Deep sequencing6723 reads, 297 experiments
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).