Mature sequence mml-miR-34c-3p

Accession numberMIMAT0006176
IDmml-miR-34c-3p
Stem-Loop mml-mir-34c
Sequence
aaucacuaaccacacggccagg
Get sequence
Deep sequencing7354 reads, 8 experiments
Predicted targets

References

1