Mature sequence mml-miR-184

Accession numberMIMAT0006218
IDmml-miR-184
Stem-Loop mml-mir-184
Sequence
uggacggagaacugauaagggu
Get sequence
Deep sequencing5289 reads, 9 experiments
Predicted targets

References

1