Mature sequence mml-miR-367

Accession numberMIMAT0006292
IDmml-miR-367
Stem-Loop mml-mir-367
Sequence
aauugcacuuuagcaaugguga
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1