Mature sequence mml-miR-425

Accession numberMIMAT0006324
IDmml-miR-425
Stem-Loop mml-mir-425
Sequence
aaugacacgaucacucccguuga
Get sequence
Deep sequencing53850 reads, 9 experiments
Database links
Predicted targets
QuickGO function

References

1