Mature sequence mml-miR-487a

Accession numberMIMAT0006346
IDmml-miR-487a
Stem-Loop mml-mir-487a
Sequence
aaucauacagggacauccaguu
Get sequence
Deep sequencing3 reads, 2 experiments
Predicted targets

References

1