Mature sequence mml-miR-661

Accession numberMIMAT0006500
IDmml-miR-661
Stem-Loop mml-mir-661
Sequence
ugccuggguaucuggcccgugcgu
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1