Mature sequence oan-miR-221-3p

Accession numberMIMAT0007135
IDoan-miR-221-3p
Previous IDsoan-miR-221
Stem-Loop oan-mir-221
Sequence
agcuacauugucugcuggguuu
Get sequence
Deep sequencing37144 reads, 5 experiments
Database links
QuickGO function

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).