Mature sequence gga-miR-1416-5p

Accession numberMIMAT0007285
IDgga-miR-1416-5p
Previous IDsgga-miR-1416
Stem-Loop gga-mir-1416
Sequence
uccuuaacucaugccgcugug
Get sequence
Deep sequencing6087 reads, 5 experiments
Predicted targets

References

1
PMID:18430245 "Deep sequencing of chicken microRNAs" Burnside J, Ouyang M, Anderson A, Bernberg E, Lu C, Meyers BC, Green PJ, Markis M, Isaacs G, Huang E, Morgan RW BMC Genomics. 9:185(2008).
2
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).
3
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).