Mature sequence hsa-miR-1469

Accession numberMIMAT0007347
IDhsa-miR-1469
Stem-Loop hsa-mir-1469
Sequence
cucggcgcggggcgcgggcucc
Get sequence
Deep sequencing60 reads, 43 experiments
Predicted targets

References

1
PMID:18402656 "Hidden layers of human small RNAs" Kawaji H, Nakamura M, Takahashi Y, Sandelin A, Katayama S, Fukuda S, Daub CO, Kai C, Kawai J, Yasuda J, Carninci P, Hayashizaki Y BMC Genomics. 9:157(2008).