Mature sequence mtr-miR1510a-5p

Accession numberMIMAT0010032
IDmtr-miR1510a-5p
Previous IDsmtr-miR1510a*
Stem-Loop mtr-MIR1510a
Sequence
uugucuuacccauuccuccca
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19068109 "High-throughput sequencing of Medicago truncatula short RNAs identifies eight new miRNA families" Szittya G, Moxon S, Santos DM, Jing R, Fevereiro MP, Moulton V, Dalmay T BMC Genomics. 9:593(2008).
2
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).