Mature sequence mtr-miR169d-5p

Accession numberMIMAT0011064
IDmtr-miR169d-5p
Previous IDsmtr-miR169d
Stem-Loop mtr-MIR169d
Sequence
aagccaaggaugacuugccgg
Get sequence
Deep sequencing reads, experiments

References

1
" Bonnet E Unpublished (2007).
2
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).
3
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).