Mature sequence crm-let-7

Accession numberMIMAT0011519
IDcrm-let-7
Stem-Loop crm-let-7
Sequence
ugagguaguagguuguauaguu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).