Mature sequence bta-miR-1584-5p

Accession numberMIMAT0011969
IDbta-miR-1584-5p
Previous IDsbta-miR-1584
Stem-Loop bta-mir-1584
Sequence
uuggggcugggcugggggca
Get sequence
Deep sequencing13 reads, 3 experiments
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).