Mature sequence hvt-miR-H4-5p

Accession numberMIMAT0012714
IDhvt-miR-H4-5p
Previous IDshvt-miR-H4
Stem-Loop hvt-mir-H4
Sequence
ggcggaggugugauauggugu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19328516 "MicroRNAs of Gallid and Meleagrid herpesviruses show generally conserved genomic locations and are virus-specific" Waidner LA, Morgan RW, Anderson AS, Bernberg EL, Kamboj S, Garcia M, Riblet SM, Ouyang M, Isaacs GK, Markis M, Meyers BC, Green PJ, Burnside J Virology. 388:128-136(2009).