Mature sequence aae-miR-306-5p

Accession numberMIMAT0014229
IDaae-miR-306-5p
Previous IDsaae-miR-306
Stem-Loop aae-mir-306
Sequence
ucagguacugagugacucucag
Get sequence
Deep sequencing2209 reads, 2 experiments

References

1
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).