Mature sequence cqu-let-7-3p

Accession numberMIMAT0014367
IDcqu-let-7-3p
Previous IDscqu-let-7*
Stem-Loop cqu-let-7
Sequence
cuaugcaauccgcuagcuuaac
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).