Mature sequence ppy-miR-544

Accession numberMIMAT0015994
IDppy-miR-544
Stem-Loop ppy-mir-544
Sequence
auucugcauuuuuagcaaguuc
Get sequence
Deep sequencing reads, experiments

References

1