Mature sequence ppy-miR-1185

Accession numberMIMAT0016148
IDppy-miR-1185
Stem-Loop ppy-mir-1185-1 ppy-mir-1185-2
Sequence
agaggauacccuuuguauguu
Get sequence
Deep sequencing reads, experiments

References

1