Mature sequence cin-miR-92d-5p

Accession numberMIMAT0016423
IDcin-miR-92d-5p
Stem-Loop cin-mir-92d
Sequence
ggucguguuugguguaucau
Get sequence
Deep sequencing917 reads, 2 experiments

References

1