Mature sequence cin-miR-4009a-3p

Accession numberMIMAT0016502
IDcin-miR-4009a-3p
Stem-Loop cin-mir-4009a
Sequence
uauugcacauguuguaccaa
Get sequence
Deep sequencing174 reads, 2 experiments

References

1