Mature sequence ssc-miR-4339

Accession numberMIMAT0017980
IDssc-miR-4339
Stem-Loop ssc-mir-4339
Sequence
gcucugagcugccccuccucgucc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20433717 "Deciphering the porcine intestinal microRNA transcriptome" Sharbati S, Friedlander MR, Sharbati J, Hoeke L, Chen W, Keller A, Stahler PF, Rajewsky N, Einspanier R BMC Genomics. 11:275(2010).