Mature sequence hsa-miR-3605-3p

Accession numberMIMAT0017982
IDhsa-miR-3605-3p
Stem-Loop hsa-mir-3605
Sequence
ccuccguguuaccuguccucuag
Get sequence
Deep sequencing630 reads, 104 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).
2