Mature sequence bfl-let-7a-3p

Accession numberMIMAT0019176
IDbfl-let-7a-3p
Previous IDsbfl-let-7a*
Stem-Loop bfl-let-7a-1
Sequence
gacuguacaacccguuaccuuu
Get sequence
Deep sequencing reads, experiments

References

1
2
PMID:21210939 "microRNA complements in deuterostomes: origin and evolution of microRNAs" Campo-Paysaa F, Semon M, Cameron RA, Peterson KJ, Schubert M Evol Dev. 13:15-27(2011).